Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38914
Clone ID OST38914
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38914
Sequence
ATGTTCTTGAGGGCTATAATGGAACAATATTTGCATATGGACAAACATCATCTGGGAAGACCCACACGATGGAGGGTAAA
CTTCATGATCCANAAGGCATGGGAATTATTCCAAGAATAGTGCAAGATATTTTTAATTATATTTACTCCATGGATGAAAA
TTTGGAATTTCATATTAAGGNTTCATATTTTGAAATATATTTGGATAAGATAAGGGACTTGTTAGATGTTTCAAAGACTA
ACCTTTCAGTCCATGAAAGACAAAAACCGTGTTCCCTATGTAAAAGGGGNGCACAGAACGTTTCGTGTGTAGTCCAGATG
AAGNTCATGGATACCATNGATGANGGGAAATCCCAANCAGACATTGGTCGCAAGTTCCAAATATTGAATTGAAC
Sequence Type mRNA
Unitrap ID UNI18294

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6225592..6226972 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006740 (Kif5b) NM_008448 kinesin family member 5B Gene [Source:MGI Symbol;Acc:MGI:1098268]

 
Come back to gene ENSMUSG00000006740


For any suggestions or comments, please send an email to unitrap@crg.es