Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38848
Clone ID OST38848
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38848
Sequence
ATGGCGGGTGAAAAAGCGCCTGATACAAAGGAGAAGAAACCTGCGGCCAAGAAGGCTGGCAGTGATGCTGCTGCCTCCCG
GCCCCGGGCCGCCAAAGTAGCCAAAAAGGTTCACCCTAAGGGTAAAAAGCCCAAGAAGGCGAAGCCCCATTGCAGCCGAA
ACCCTGTCCTGGTGAGAGGAATTGGCAGGTACTCCCGATCTGCTATGTACTCCAGGAAGGCCTTGTACAAAAGGAAATAC
TCGGCTGCCAAGACCAAGGTTGAGAATAAGAAGAAAAAAGAGAAGGTCCTTGCTACTGTCACCAAAACAGTTGGTGGGGA
CAAGAACCGTGGCAACCCGGTTGTTGAAGCTTCGAAAAATGCCTAGGTATTATCCCACCGAAGATGTTCTTGT
Sequence Type mRNA
Unitrap ID UNI16951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121655415..121656703 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029614 (Rpl6) NM_011290 ribosomal protein L6 Gene [Source:MGI (curated);Acc:Rpl6-001]

 
Come back to gene ENSMUSG00000029614


For any suggestions or comments, please send an email to unitrap@crg.es