Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38748
Clone ID OST38748
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38748
Sequence
GGAGCCCCCGGGCCACGGCATCAGCGCTGCACTTCCCTTCCACGTCCATCATCCAGCAGTCGAGCCCGTATTTCACACAC
CCAACCATCCGCTACCACCACCACCATGGGCAGGACTCGCTGAAGGAGTTTGTGCAGTTTGTGTGCTCTGACGGCTCGGG
TCAGGCCACCGGACAGCATTCACAACGACAGGCGCCTCCTCTGCCAACCGGTTTGTCAGCATCGGATCCCGGGACGGCAA
CTTTCTGAACATCCCACAGCAGTCTCAGTCCTGGTTCCTCTGATTAAGATCAACAAAGAAACAACTAAATTTAAAAAAAG
AAAA
Sequence Type mRNA
Unitrap ID UNI17168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87232521..87245717 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001911 (Nfix) NM_010906 nuclear factor I/X Gene [Source:MGI (curated);Acc:Nfix-002]

 
Come back to gene ENSMUSG00000001911


For any suggestions or comments, please send an email to unitrap@crg.es