Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38647
Clone ID OST38647
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38647
Sequence
ACTGAGATTTTCCAGGGGATTCCATGACCCATGCCTTTCTCCTTTAGTGCATGACTTGATTTGTAACCTTGGGTTTGAAC
TCAAAGAAATNTGTGATATCAATAGCATTGTAACTCAAAATGGNGAAGTACGATGGAAAGCAATTACTGACCGTGTGAGA
TATGAAGAATTAGGTTTGTATTCTCTTTGTACATCAAGCTTCCGTTAGTACTGTNACATTAAAAATTTGTTGTGTGGTTA
AACAAA
Sequence Type mRNA
Unitrap ID UNI14595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116463..15116703 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es