Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38613
Clone ID OST38613
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38613
Sequence
AATTGAAGCCATCACGAGCTCAGGACAGATGGGCTCTTTCATACGTCTGAAGCAGTTCTTGGAGAAATGTCTGCAACGAA
GGGAGATTCCTGTGCCCAGAGGCTTTCTGACAACCTCCTTCTGGCGCTCCTGATGTCCTCCGTCACACTGTGTGGCAGGA
GGGGCAACAATAAAGCAACTGGGACAGCGGGCTTGGAAGAATCATGTCAGATTGAGAAATTCGTCAGTGTGTTTTTATAT
ATCTGTACCCCATGAATAAGGCTTTTATAGTTCACAAA
Sequence Type mRNA
Unitrap ID UNI28147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29813270..29814178 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019715 (Gle1) NM_028923 GLE1 RNA export mediator (yeast) Gene [Source:MGI (curated);Acc:Gle1-001]

 
Come back to gene ENSMUSG00000019715


For any suggestions or comments, please send an email to unitrap@crg.es