Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38583
Clone ID OST38583
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38583
Sequence
AATGTGAAGCTCTTGGAACAGTTTGTCTGTGCACACACGGGTATCATCTTTCACGCCCCATACACAGGGGTCTGTATGAA
GCAGCACAAGAAGCTGACCCAGGCCATCCAGAAAGCCAGGGAGTGTGGTCTTCTCAGTTACTACGTCCCCCAGGTTGAGC
CCCGGGATGCTGACTTTGGTACTGTGCATGGAGCTGTCAGTGTGACTCCACCAGCCCCCACACTGTTGTCAGGTGAACCT
TGGTACCCATGGTACAGCTGGCAACAGCCACCAGAGAGAGAGCTGTCTCGCCTTCGCCGACTCTATCAAGGAAATCTCCT
AGAAGAAAGTGGCCCGCACCTGAGTCGATGCCAGAGATGCCCACTACACCACCAGCAGAATCCTCCATTGAGCAGCCAGG
CTCC
Sequence Type mRNA
Unitrap ID UNI28150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36047624..36049349 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024436 (Mrps18b) NM_025878 mitochondrial ribosomal protein S18B Gene [Source:MGI Symbol;Acc:MGI:1914223]

 
Come back to gene ENSMUSG00000024436


For any suggestions or comments, please send an email to unitrap@crg.es