Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38572
Clone ID OST38572
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38572
Sequence
CTTCTTGTGCCTCACAGCTTCCCCCAGAGATACTTCTCCTTGGTCCCAGCTGTGGCTTCCCTGAGTGTCCAGCTGAGTTG
TTTGCAGTTACCAGCTTCAGAAAATGTCAGCATGAGGTTATGCAATGGTCTCTGCAAGATGTTTTATTCTTGAATTGGAA
CCTTTTACGACTGACAAATGCTGGTACTTTATCTCCTATAAGTGGACTATAATTTCT
Sequence Type mRNA
Unitrap ID UNI15532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12630361..12671150 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es