Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38559
Clone ID OST38559
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38559
Sequence
GAAACCTGCCATATGAATATAAAATTGTGATTGCTGGGAATCATGAACTGACATTTGATAAGGAATTCATGGCAGACCTC
GTTAAACAGGACTACTACCGTTTCCCTTCTGTGTCCAAATTGAAACCAGAGGACTTTGACAATGTTCAGTCCCTCCTGAC
AAACAGTATTTACTTGCAAGATTCAGAGGTAACCGTGAAAGGATTCAGGATATACGGTGCACCCTGGACCCCGTGGTTTA
ATGGATGGGGCTTTAACCTACCCAGAGGCCAGTCTCTGCTGGACAAATGGAACCTAATCCCTGAGGGCATCGACATACTC
ATGACACACGGACCTCCTCTAGGTTTTCGAGACTGGGTTCCAAAGGAACTTCAAAGGGTGGGCTGCGTGGA
Sequence Type mRNA
Unitrap ID UNI18248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 106623790..106704860 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016386 (Mpped2) metallophosphoesterase domain containing 2 Gene [Source:MGI (curated);Acc:Mpped2-001]

 
Come back to gene ENSMUSG00000016386


For any suggestions or comments, please send an email to unitrap@crg.es