Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK522
Clone ID XK522
Vector pGT0Lxf
Project baygenomics

Sequence tag XK522
Sequence
CGGCGGCCTTGGAGGAGGTCATGAAGGACCTGAGCCTGACGCGGGCCGCGCGGCTTCAGCTGCAGAAGTCCCAGTACCTG
CAGCTGGGCCCCAGCCGTGGCCAGTAGTACGGTGGGTCCCTGCCCAACGTGAACCAGATTGGAAGCAGCAGCGTGGACCT
GGCCTTCCAGACCCCATTTCAGTCCTCAGGCCTGGA
Sequence Type mRNA
Unitrap ID UNI9105

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72930089..72963384 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003575 (Crtc1) NM_001004062 CREB regulated transcription coactivator 1 Gene [Source:MGI (curated);Acc:Crtc1-001]

 
Come back to gene ENSMUSG00000003575


For any suggestions or comments, please send an email to unitrap@crg.es