Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK523
Clone ID XK523
Vector pGT0Lxf
Project baygenomics

Sequence tag XK523
Sequence
GACTCTTCTGTGTGTGCGAGCGCGGAGGCTGCGTGCTGGTCAATCGCTGCCGCCCTGCGCCCTGCGGAGCTCCAGAGCTC
GAACCCCAGCCCTGGAAACCCAGGAATGTAAAGACATCAAAATGGAGCCAAGTGTGGATGCAAATTCAATTACTATCACT
GTTGAGGGAATGACATGTATTTCCTGTGTCCGGACCATTGAACAGCAGATTGGGAAAGTGAATGGTGTCCATCACATTAA
A
Sequence Type mRNA
Unitrap ID UNI9083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103222616..103265246 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es