Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38529
Clone ID OST38529
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38529
Sequence
GTTTGCCTTCGTGGTTTCCAGTTGCCATGAGGAAGCCTCGCCGAAAGTCACGGCAGAATGCCGAGGGCCGGAGATCCCCA
TCCCCATACAGTCTTAAGTGCTCACCCACACGGGAGACCCTGACTTACGCCCAAGCCCAGAGGATTGTTGAGGTCGACAT
CGATGGCCGCCTACATCGGATCAGCATTTATGACCCACTTAAGATCATCACTGAAGATGAGCTGACTGCTCAGGATATTA
CCGAATGCAATAGCAACAAGGAAAACAGTGAGCAGCCCCAATTCCCTGCCAAGTCCAAGAAACCCTCATCAAAGGGCAAA
AAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28942874..28943192 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063952 (Brpf3) NM_001081315 bromodomain and PHD finger containing, 3 Gene [Source:MGI (curated);Acc:Brpf3-001]

 
Come back to gene ENSMUSG00000063952


For any suggestions or comments, please send an email to unitrap@crg.es