Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38463
Clone ID OST38463
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38463
Sequence
GTATTTCTTCCAGGGTAAAAAGCACNGGAATTGGCCAATCCGGCGNGNACNNAANCAGGCTGAACNGTGNNCNGAAGGAN
NNGNCTACCTCCAGGNTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGNTCCTGACAACCCTCCATATGATAAG
GGAGCCTTNAGAATTGAAATCAACTTTCCAGCAGAGTATCCATTCAAACCACNCAAGATCACATTTAAAACAAAGATCTA
CCACCCTAACATCGATGAGAAGGGGCAGGTCTGTCTGCCAGTCATTAGTGCTGAAAACTGGAAGCCAGCCACCAAGACTG
ACCAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCACTCCGGGCTGACCTAGCTGAAGAA
TACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGAAGAGTTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTA
AAATCTGCCATGAGTGATTCCAGCAAGTTTGAGCAGAGACCCCGAGCAGTGCATTCAGACACCCCGCAAAGCAGGACTCT
GTGGAAATTGACACGTGCCACCAACTGGCGTCCGCTTGTGGCAGTTCTAACTTTCTACAGTTTTCTTAATCCAAAGTGGT
CTAGGTACCTGTAAAGAANGATTAAANAAATTCAGATGTTCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI4483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17154018..17176557 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es