Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK542
Clone ID XK542
Vector pGT0Lxf
Project baygenomics

Sequence tag XK542
Sequence
AACTCCTTGTATAAGAAGGGCCCCAATGGCTATGACCCCCAGTTCATCACCAAACTGCTCCGCAACTACAGGTCTCACCC
CACCATCCTGGACATCCCTAACCAGCTGTACTACGACGGAGAGCTGCAGGCCTGCGCAGATGTGGTGGATCGAGAACGGT
TCTGCCGCTGGGAGGGGCTGCCTCAGCAGGGCTTCCCCATCATTTTCCATGGTGTAATGGGCAAAGATGAGAGAGAAGGC
AATAGCCCATCCTTCTTCAACCCTGAAGAGGCTGCTACAGTGACGTCATACCTGAAACAACTCCTGGCCCCTTCCTCCAA
GAAGGGTAAAGCCCGCCTGAGCCCCCGAAATGTGGGCGTCATCTCCCCGTACCGGAAGCAGGTAGAAAAAATCCGTTACT
GCATCACAAAACTTGACCGAGAACTTCGCGGACTGGATGACATCAAAGATTTGA
Sequence Type mRNA
Unitrap ID UNI9110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104599687..104602380 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es