Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK551
Clone ID XK551
Vector pGT0Lxf
Project baygenomics

Sequence tag XK551
Sequence
GTAGAATTCAGTTATATTTCAAAAATAAGCCTGAACACACCACCTGGCACAAAAGTGAAGCTCTCTGGCACTGTGGACAT
AAAGAACGGATTCCTGCTCTTAAGTGACTCTAACACCACAGTTCTTGGTGGTGAAGTGGAACACCTAATTGACAAGTGGG
CTTTACAGAGAAGCTTATTAAAGCATAACAGAAGCAATATTGGAGCTGAAGGTGGCCCACCTCCTTTTCTACCTTTTGGG
CAGAAGTGTGCATCTAACGTCCAAGTGGATAGCAGAGAGCTTGATGGAAGAAAGACATTACAAGTTTCCCTGCCTGCCAA
GCCTGCGAATGATAATGATGAATTT
Sequence Type mRNA
Unitrap ID UNI9112

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87872015..87880642 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022019 (Tdrd3) NM_172605 tudor domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444023]

 
Come back to gene ENSMUSG00000022019


For any suggestions or comments, please send an email to unitrap@crg.es