Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK552
Clone ID XK552
Vector pGT0Lxf
Project baygenomics

Sequence tag XK552
Sequence
AGGTGTGTATGCTAATGGGAATGACAACAAGAAATTTAAAGGAGATAGACCTCCCTGTTCGCCTTCCCGTGTTCTCCATC
TTCGAAAAATTCCATGTGATGTCACCGAAGCAGAGGTCATATCATTAGGTCTACCATTTGGCAAAGTAACTAATCTTTTG
ATGTTGAAAGGAAAAAGCCAGGCCTTTTTAGAAATGGCTTCTGAAGAAGCTGCTGTTACTATGATAAATTATTACACTCC
TGTTACTCCTCATCTTCGAAGTCAGCCTGTTTATATCCAGTATTCCAATCACCGAGAACTTAAGACTGACAATCTGCCTA
ATCAGGCTAGAGCCCAAGCTGCACTGCAGGCTGTCAGTGCAGTCCAGTCAGGAAACTTGTCCCTTCCTGGAGCTACTGCA
AATGAAGGCACATTGCTACCTGGGCAGAGCCCTGTGCTCCGGATAATTATTGAAAACCTATTTTACCCTGTCACTCTGGA
AGTTCTCCAT
Sequence Type mRNA
Unitrap ID UNI9113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59514185..59908419 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028382 (Rod1) NM_144904 ROD1 regulator of differentiation 1 (S. pombe) Gene [Source:MGI (curated);Acc:Rod1-001]

 
Come back to gene ENSMUSG00000028382


For any suggestions or comments, please send an email to unitrap@crg.es