Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST38083
Clone ID OST38083
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST38083
Sequence
GAACTGAGATCTGCCACCTCCCTCCTTCTAGACGGGACTTGACTGCTAAAGCGCCTTGAGTACCTGAGAGTCTCCATTAG
AATCTGCTTTGGAAGCAAGAACAGACTATACCATTATGGATGGAGAGGACGATAGTAACCTTGTCATCAAAAAGAGGTTT
GTGTCTGAGGCAGAGCTAGATGAGCGGCGCAAAAGGAGGCAAGAAGAATGGGAGAAAGTGCGAAAACCAGAAGACCCAAA
AGAATGTCCAGAGGAGGCGTATGACCCTCGGTCTCTGTACGAACGGCTGCAGGAACAGAAAGACAGGAAGCAGCAGGAGT
ATGAGGAGCAATTCAAATTCAAAAACATGGTAAGAGGGTTAGACGAAGATGAGACCAACTTCCTTGATGAGGTTTCTCGG
CAGCAGGAGCTGATAGAGAAGCAGCCGGCCGAGAAGAAGAACTAGAGGAACTGAAGGAGTCAGAAGTAATCTCAACAAGG
TTGGAATTTCTGCAGAAAATAATAGAANTANAGAATAAGCTGGCCGTGAAACCCATTGAAACCAAGGAACAAAGTTCTCC
CAGGGCAAAGCTGGTTGGGCNAGGAGCCTGTGGAAACATTNAGAGCTCATTANAGTGNCAATTAGGTGTGAAAGAGANCT
GGAATCCNNGAACCCCGACCCCANGATGACCNAGGGCTTCAAAGAGGCCCCNGNCCTGCNNTGTCTCTTTGGGAAAGCTN
TTTTTCTGAANNCGGACCTTCCCTCCATTCCACTTGCCCNGTTGGGCTTGCTTGTGNTGCCATCNGNNTTTCTNCCCTTG
GCTTTGGGCCCCCTAATTCTGGGGGA
Sequence Type mRNA
Unitrap ID UNI12688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97106792..97113309 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031774 (2310065K24Rik) NM_028221 RIKEN cDNA 2310065K24 gene Gene [Source:MGI Symbol;Acc:MGI:1919637]

 
Come back to gene ENSMUSG00000031774


For any suggestions or comments, please send an email to unitrap@crg.es