Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST37817
Clone ID OST37817
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST37817
Sequence
ATCCCAAGGAAGAGAAAGAAGATGATTCTGTCCTCCCTCAGGAAGTTTCCATTACTACAACTAGAGCTAGCCGGAGCTGG
CGCAGTAGTAGCAGGACCTCTATCTCTCGCCTTCGAGACAGTGAGAATACTCGGAGCTCTAGGTCCAAGACTGGCTCCTT
GCAACTCGTCTGCAAGACAGAACCAATTACTGATCAACTTGATTATGATGTTCCAGAAGAACATCAGTCTCCCGGTGGCA
TTAGTANTGATGANGAAGAGGANGAGGAAGAATAAATGTTAATTCACTGACGANGAANTACCCCTTTCCATGGACT
Sequence Type mRNA
Unitrap ID UNI11554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12853114..12853589 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024695 (Zfp91) NM_053009 zinc finger protein 91 Gene [Source:MGI (curated);Acc:Zfp91-001]

 
Come back to gene ENSMUSG00000024695


For any suggestions or comments, please send an email to unitrap@crg.es