Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST37803
Clone ID OST37803
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST37803
Sequence
TTTGGTTTCTCTGGATATTTCTTCATTAAGACTTTAAAAATGTCATCCAAACAAGAAATAATGGATGACCAGCGGGTCAG
GCGGGTTTCAAAGGATCCCAGATTTTGGGAAATGCCAGAAAAGGAACGAAAAGTCAAAATTGACAAGAGGTTTCGAGCCA
TGTTCCATGATAAAAAGTTTAAATTGAACTATGCTGTTGATAAAAGAGGTCGTCCTATCAGTCACAGCACTACAGAAGAC
TTGAAGCGCTTCTATGACCTTTCAGACTCTGATTCTGATCTCTCTGATGAAGAAAGCAAAATACTCAGTCAGAAGAAAGC
GAAGCAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI18241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 139993857..139994189 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045624 (Esf1) NM_001081090 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Esf1-001]

 
Come back to gene ENSMUSG00000045624


For any suggestions or comments, please send an email to unitrap@crg.es