Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST37794
Clone ID OST37794
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST37794
Sequence
GTATCGCCAGGCCGAAGAGCAGAAGCTGCCACCATGGTTGCGCTTTCNCTGAAGATTANCATTGGGAATGTGGTGAAGAC
GATGCAATTTGAGCCATCTACCATGGNGTACGACGCCTGCCGCATGATTCNTGAGCGGATCCCAGAGGCCCTGGCTGGCC
CTCCCAACGACTTTGGGCTCTTTCTGTCAGATGATGACCCCAAAAAAGGCATCTGGCTAGAGGCTGGGAAAGCTTTGGAC
TACTACATGCTCCGAAATGGGGACACCATGGAGTACAGAAAAAAGCAGAGACCCCTGAAGATCCGGATGTTAGACGGAAC
GGTGAAGACTATCATGGTGGATGACTCCAAGACCGTCACAGNCATGCTCATGACCATTTGTGCCCGAATTGGTATCACCA
ACCATGATGAGTATTCACTGGTTCGAGAGCTGATGGAAGAAAAGAAAGATGAGGGGACAGGGACCCTGAGAAAAGACAAG
ACCCTACTGCGAGATGAAAAATT
Sequence Type mRNA
Unitrap ID UNI16919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43568518..43569655 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es