Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST389
Clone ID RST389
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST389
Sequence
AACCATTCAGTGCCTTCGAGTGTGGGAACAAGAAGTTCTGTGTCAGGAGTCCTTTGAACTGTGATCCAGAGAAGGAGCCT
GCATGCGTCTTCCTGTCCTTCACCAGAGACAACCAGTCAGTGATGGTTGAAATGAGCGGACCCAGTGACGGCTATGTGTC
GTTTGCATTTTCTCACGACCAGTGGATGGGCGACGATGATGCTTACTTGTGCATCCGTGAGGACCAGACAGTAGATATAC
AGCCTTCCTACTTGACAGGGAGAAGTTATCCTGTGATGGACTCCAGGGGGACTCTGGAGGACATGGCCTGGAGGCTGGCG
GACGGCGTCATACAGTGTTCATTCAGAAGAAACATCACCCTTCCTGAGGCTAAGAACAGATTTGTGCTGAATGAGAGCTA
CTACATATTCTTCGCAGAAGGCCCGTTTCACGAC
Sequence Type mRNA
Unitrap ID UNI9134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116588025..116594904 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033386 (Frrs1) NM_009146 ferric-chelate reductase 1 Gene [Source:MGI Symbol;Acc:MGI:108076]

 
Come back to gene ENSMUSG00000033386


For any suggestions or comments, please send an email to unitrap@crg.es