Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST37469
Clone ID OST37469
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST37469
Sequence
GTCTCCGGGCACAATGGAGGACAAACGGAACATCCAGATCATCGAGTGGGAGCACCTGGACAAGAAGAAGTTCTATGTGT
TTGGTGTTGCTATGACAATGATGATCAGGGTCAGCGTGTACCCGTTCACCCTCATCCGCACCCGCCTGCAGGTCCAGAAG
GGCAAGAGCCTCTACCACGGGACCTTCGATGCCTTTGTCAAGATCCTGCGAGCAGATGGAGTGGCGGGCCTCTACCGGGG
GTTCCTGGTCAACACCTTCACACTCATCTCCGGCCAGTGCTATGTCACCACTTACGAGCTCACCCGGAAGTTTGTGGCAG
ACTACAGCCNGAAGNACCNCAGTCAAATCACTCGTAGCCGGGGGCTCGGCTCCCTTGTGGCCCA
Sequence Type mRNA
Unitrap ID UNI28198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88224677..88225060 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050144 (Slc25a44) NP_848811 solute carrier family 25, member 44 Gene [Source:MGI Symbol;Acc:MGI:2444391]

 
Come back to gene ENSMUSG00000050144


For any suggestions or comments, please send an email to unitrap@crg.es