Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST37412
Clone ID OST37412
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST37412
Sequence
GTTCCTGCCTCAAGACCAGTTGGGTACATCTTTGACACGCCCTCCCACCATGCACTCCTTGGACGAGCCCCTCGACCTAA
AGCTGAGCATCACCAAGCTCCGAGCGGCAAGAGAGAAGAGAGAAAGGACACTGGGTGTGGTCCGGNATCATGCTTTGCAT
CGAGAGCTGGGCCTGGTGGANGATAGCCCCGCCCCTGGCTCCCCAGGCTCTCCACCANCANGTTTCCTGCTGAACCCCAA
ATTCCCTGAAAAGGTGGACGGACGCTTTTCTGCAGCCCCCTTGGTGGACCTCAACTTGTCACCACCCTCTGGACTGGACT
CTCCCAATGGCAGCAGCTNCCTGTNTCCTGAGTGCCAGGGCAATGGGGACTTGCCTCCACTGNCTACTGCTGTGGATTTN
CAGCCACTTGCTATTTGGATGGGGCCCCAGTTCCTTCCAGNTCTTNNTGCCCCTGGGTTCTGGTGGGGCTNTGCANCTAC
CTGCTTGCTACTTTCTTNCCCCCCCCAAANGACAAGNGCCTTNTTANCANAANCTNCCCCTTGGGCAAAACAACCTGGTG
GNGNNCCAATTNGGCCCAAAGTGGTTNAACCACNCNTNTTTTTGAGCTTCCTTTNCAAAANAACCCTNGGNTTGNACCCA
ATTTTTTCAAACNCGAACCCAATTANTGNGTTCAAAAAACCCCTTGGNAAACAANGGGAATGGCCTTCCGAAANAAACTT
NGGGTTGGGNCAAATTTTGGGNAAAAAGGGGCTTGTNGGCCCCCCNGCCNCATTGGNNCCCCTGGGGCTTTTCCAAAAGG
Sequence Type mRNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4608598..4611431 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es