Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST448
Clone ID RST448
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST448
Sequence
GCGCCATGTGGCTGCTGGGGCCGCTGTGCCTGCTGCTGAGCAGCACTGCGGAGAGCCAGCTGCTCCCTGGGAACAACTTC
ACCAACGAGTGCAACATCCCAGGTAACTTCATGTGCAGCAACGGGCGGTGCATCCCGGGCGCCTGGCAGTGTGACGGGCT
GCCTGACTGCTTCGACAAGAGTGACGAGAAGGAATGCCCCAAAGCAAAATCAAAATGTGGCCCGACCTTCTTCCCCTGCG
CCAGTGGCATCCACTGTATCATCGGCCGCTTCCGCTGCAATGGATTTGAGGACTGTCCCGACGGCAGCGACGAGGAGAAC
TGCACAGCGAACCCCCTGCTTTGCTCCACGGCTCGCTACCACTGCAGGAACGGCCTGTGCATCGACAAGAGCTTCATCTG
CGATGGTCAGAATAACTGTCAAGACAACAGTGACGAGGAGAGCTGCGAGAGTTCTCT
Sequence Type mRNA
Unitrap ID UNI1240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101898066..102026487 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es