Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST455
Clone ID RST455
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST455
Sequence
CATGAAGGGGGTCAGTCCTACAAGATTGGCGACAAGTGGAGGAGGCCACATGAGACTGGTGGCTACATGTTAGAGTGTCT
GTGTCTGGGAAATGGAAAAGGGGAATGGACCTGCAAACCTATAGCTGAGAAGTGTTTTGATCATGCTGCTGGGACGTCCT
ACGTCGTGGGGGAGACCTGGGAAAAGCCCTACCAAGGCTGGATGATGGTGGACTGTACTTGTCTAGGCGAAGGCAATGGA
CGCATCACCTGTACCTCCAGAAACAGATGCAACGATCAGGACACCCGGACATCCTATAGGATTGGAGACACGTGGAGCAA
GAAGGACAACCGAGGAAACCTGCTTCAGTGTGTCTGCACAGGCAATGGCAGAGGGGAGTGGAAGTGTGAGCGACATGCTC
TACAAACTGCTTCAGCC
Sequence Type mRNA
Unitrap ID UNI9139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71692122..71695891 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es