Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST456
Clone ID RST456
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST456
Sequence
GGCTCTCTGCTCCTCCCTGTTCCAGAGACGGCCGCATCTTCTTGTGCAGTGCCAGCCTCGTCCCGTAGACAAAATGGTGA
AGGTCGGTGTGAACG
Sequence Type mRNA
Unitrap ID UNI6920 UNI6921 UNI6922 UNI6923 UNI6924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166349: 396349..396443 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078142 (AC147142.2-201) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12504571..12504665 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078300 (AC150660.4) Glyceraldehyde-3-phosphate-dehydrogenase Fragment [Source:UniProtKB/TrEMBL;Acc:Q6IWE3]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20235995..20236089 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078965 (OTTMUSG00000005300) NP_032110 predicted gene, OTTMUSG00000005300 Pseudogene [Source:MGI Symbol;Acc:MGI:3650751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51430776..51430870 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078308 (CT030181.13)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12114426..12114520 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079360 (AC158396.2-202) GAPDH Fragment [Source:UniProtKB/TrEMBL;Acc:Q2VWQ4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60029026..60029120 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070025 (AC130841.4) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TUZ9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83825353..83825447 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079501 (AC156283.6) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107910299..107910393 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078636 (AC150744.2) GAPDH Fragment [Source:UniProtKB/TrEMBL;Acc:Q2VWQ4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 13043413..13043507 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073212 (OTTMUSG00000017911) predicted gene, OTTMUSG00000017911 Pseudogene [Source:MGI Symbol;Acc:MGI:3709612]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57384805..57384899 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078696 (AL772328.13)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142625502..142625596 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078162 (AC102196.7) NP_032110 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)(EC 1.2.1.12) [Source:UniProtKB/Swiss-Prot;Acc:P16858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77440170..77440264 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081221 (AL808132.5)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28790108..28790202 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083773 (AL732526.8)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 15259857..15259951 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073737 (AC166075.2)  

 
Come back to gene ENSMUSG00000073737


For any suggestions or comments, please send an email to unitrap@crg.es