Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST37148
Clone ID OST37148
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST37148
Sequence
CCAGACTGTTGATCTCCTCATGCAAGAGTCAGGATGTCGTTTAGAGCATCCTTCTGCTACCAAATTCCGAAATCATGTCA
TGGAAGGAGACTGGGATAAGGCAGAGAATGACCTGAATGAGCTAAAGCCTTTAGTGCATTCTCCTCACGCTATTGTGGTA
AGAGGCGCACTTGAAATCTCTCAAACGTTGTTGGGAATAATTGTGAGGATGAAGTTTCTGCTGCTGCAGCAGAAGTACCT
GGAATACCTGGAGGACGGCAAGGTCCTGGAGGCACTTCAAGTTCTACGCTGCGAACTGACGCCGTTGAAATACAACACCG
AGCGCAT
Sequence Type mRNA
Unitrap ID UNI28209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 183133170..183139443 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038733 (Wdr26) NM_145514 WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]

 
Come back to gene ENSMUSG00000038733


For any suggestions or comments, please send an email to unitrap@crg.es