Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36920
Clone ID OST36920
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36920
Sequence
ACTGAGACTATGCAATGCTGNGAGATGCCCTACTGATGAATTATCTTTAAGCAACTGTGCGGTTGTGAACGAAAAAGATT
TCCAGTCTGGCCAGCATGTGATGGTGAGGACGTCCCCCAATCACAAGTACATATTTACGCTGAGGACCCATCCGTCAGTG
GTTCCAGGATGCATCGCGTTCAGCTTGCCTCAGCGAAAATGGGCTGGACTTTCTATTGGACAGGACATAGAAGTTGCCTT
GTATTCGTTTGACAAAGCCAAGCAGTGCATCGGCACAATGACCATCGAGATCGACTTCCTGCAGAAGAAGAACATCGACT
CCAACCCTTACGACACCGACNAGATGGCCGCCGAGTTCATCCAGCAGTTNAACAACCAGGCCTTCTCAGTGGGG
Sequence Type mRNA
Unitrap ID UNI20061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103777826..103792131 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es