Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST399
Clone ID RST399
Vector pGT2TMpfa
Project baygenomics

Sequence tag RST399
Sequence
CAGGAGTTTTTGAGAGCTCAGGAGCCCGGCCGGATTGTGGCTATTGCTGTTGGAGACTCAGCAGTCAAGAGCCTGTTACA
GGGAACAATCCAGATGATCCAGGATCGGTTGGGGAGTAAACTGATCCAAGGTCTGGGCTACAGGCAAGCTTGGGCCTTAG
TTGGTGTCATCGATGGTGGAAGTTCTTCCTGCAATGAATCTGTGAGAAACTATGAAAACCATAGCACTGGGGGGAAGGCC
CTGGCTCAAGGAGAATTCTACACCCTGGACGGTCAGAAGTTCTCTGTGACAGCCTACAGTGAATGGAGTCAAGGAATCTC
CCTCTCAGGCTTCCGGGTGGACATTGCGGATGGAGTGAAGCTTCACCTGTTGGTGAAA
Sequence Type mRNA
Unitrap ID UNI9147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21872776..21881908 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es