Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36725
Clone ID OST36725
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36725
Sequence
TCACCTACAAAAGCTGTATATAATGCCAGGCATTGGAATCATCCAGACTCGGAAGAATTGCCTGGACCACCAATAGCAAA
ACCTCAGCGTGTCACAGTGAGGCTGTCTTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35535450..35535550 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es