Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36713
Clone ID OST36713
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36713
Sequence
GGTTCCAGGACATAGTCTGAGGCAAGATGGAGGGTGTGAGGGCCTTCACACTTCACTTCATCTCTCCTACCCATCACAGC
ATACAAAGCAACTACACCTGGATTTTTCCAAACAACTTTTATTTCCTCAAAGTCTTCCTTAACCCTATGGAGCAAGAAGC
TGCCACTGAATAGGGCCCAGTATAGGGGCTGCTTTCTTTTCTACTCCCTCCCCCCAATACAAAAATATAGATATATATAT
ATAGATATAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17631

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31208891..31209139 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038803 (2310016E02Rik) NM_024460 RIKEN cDNA 2310016E02 gene Gene [Source:MGI Symbol;Acc:MGI:1914945]

 
Come back to gene ENSMUSG00000038803


For any suggestions or comments, please send an email to unitrap@crg.es