Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36708
Clone ID OST36708
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36708
Sequence
GAGTATAAACACGAAGCTTGCTCGAGTAACCCAGGTCCGCAAGGAACTCAAGTCCCACATTCAGAGCTTGCCAGACCTTT
CGCTGTTGCCTAATGTCACAGGGGGCCTGGCACCTCTGCCCTCTGCTGGTGACCTCTTTTCAACTGACTAGGACAGGTAT
CATGCCCCAGGTTCCCATGTGTGCCAGAGAAAAGAAGCAAGTCACTGCTGGAGACAGTCCCCTGCCCCAGCTCCATCTCT
TCAGCCAGCATCTGCCTCAGTAATGAAGCGGGGAACTCTGACTTCTTACTCTCCTCCGGCTCCCTCTGAGCATGGTTCAG
AGCCATGCAGATGGACTCAGTTTTGATTCATATTTGCTTAGAACACAGACTTTTCCTTCCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI21367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157900666..157901045 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027651 (Rprd1b) NM_027434 regulation of nuclear pre-mRNA domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1917720]

 
Come back to gene ENSMUSG00000027651


For any suggestions or comments, please send an email to unitrap@crg.es