Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36661
Clone ID OST36661
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36661
Sequence
CATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAACAGCGAAAGGAACGCAAGAACAGAATGAAGAAGGTCAGGGGCAC
GGCGAAGGCCAATGTTGGTGCTGGCAAAAAGCCAAAGGAGTAGATCTGCGGTGACTTGATGTTTTGCTGTGATGTGCAGA
TTTCTGAGAGGACAAATAAACTAAAAAGCTCCTA
Sequence Type mRNA
Unitrap ID UNI21045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25312605..25315079 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025290 (Rps24) NM_011297 ribosomal protein S24 Gene [Source:MGI Symbol;Acc:MGI:98147]

 
Come back to gene ENSMUSG00000025290


For any suggestions or comments, please send an email to unitrap@crg.es