Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE012
Clone ID RRE012
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE012
Sequence
GGTTGCGGCCGAAACCCGGAGCCGCGAACAGGATTGAGTAGCGGCCGCGGCCACCGCAGGACGGCGCCGTTCTCCGCTAC
GGGCTTCCAGGTCGCCGTTGGCTGCACTGCCGGCCTTGGTGAATATTTGGATGAAGCCATTAGACTAATTGCTTGCCATC
ATGAGCAGAAGCAAACGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTAAAACGATACCA
GAATTTAAAGCCTATAGGCTCAGGAGCTCAAGGAATAGTGT
Sequence Type mRNA
Unitrap ID UNI9152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 34224043..34260312 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021936 (Mapk8) NM_016700 mitogen-activated protein kinase 8 Gene [Source:MGI (curated);Acc:Mapk8-001]

 
Come back to gene ENSMUSG00000021936


For any suggestions or comments, please send an email to unitrap@crg.es