Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE013
Clone ID RRE013
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE013
Sequence
GGCTGGCGCTCTACGTGGCCGGACTCAACGCGCTGCTGCTGCTACTCTACCGGCCGCCGCGCT
Sequence Type mRNA
Unitrap ID UNI7408

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151671610..151671672 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039662 (Icmt) NM_133788 isoprenylcysteine carboxyl methyltransferase Gene [Source:MGI (curated);Acc:Icmt-001]

 
Come back to gene ENSMUSG00000039662


For any suggestions or comments, please send an email to unitrap@crg.es