Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36627
Clone ID OST36627
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36627
Sequence
ATGGCCGCCCTGCACCCCCAATGAAAGGCCAACTTCGAAGAAAAGCTCAAAGGGAGAAGCTTGCAAGACGAGTTGTACTG
CTGACACAGGAAATGGATGCTGGAATACAGGCATGGAAGCTCAGGCAGCAGAAATTGCAGGAAGAAAGGAAGAAGGAACA
TGATCTCAAACCTAAAGGGACTTTACTGAGAAGCCCACTTCCGAATCAATAAAAAGCAGCTCCTGCCCCACTTAAAAAAA
AAAA
Sequence Type mRNA
Unitrap ID UNI17000

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55048419..55048586 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010406 (Mrpl52) NM_026851 mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]

 
Come back to gene ENSMUSG00000010406


For any suggestions or comments, please send an email to unitrap@crg.es