Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36542
Clone ID OST36542
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36542
Sequence
ATGATTGTGGATTCTGCTGTGGGATTAGAAGCCACGTCTGTTGTGATCGGAAAACTCCAGGAATAGCGGCCGAGATGGAT
GAACAGGCTCTTTTAGGGTTAAATCCAAATGCCGATTCAGACTTTANACAGAGGGTAAGTCAGTCAATGTAACTATTTTG
AAAAGCATGCAACCATAAACACGTGTCAGAGGATTTAGACAGCAAACACATNTGATGATAGAGGTATAATTTGAGTAAAC
ATTAATAAAACCAAACATATTTGAGGCATGTTCTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121059771..121060047 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034667 (Xpot) NP_001074525 exportin, tRNA (nuclear export receptor for tRNAs) Gene [Source:MGI Symbol;Acc:MGI:1920442]

 
Come back to gene ENSMUSG00000034667


For any suggestions or comments, please send an email to unitrap@crg.es