Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36427
Clone ID OST36427
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36427
Sequence
TGGAATAGAAGATGAACTCAACTGAAATCAGTGAAGATGTAGAAGAAGTTCTAAAAAATAACCCCGTGAAGGCAGAGGGC
AGCGACGCTACGTTGGACTGCTCCCGGAACTCCAGGGCCTCTGAGAAGCACCTTCTGGAGAGCGTCCTCACCGCCCTCCA
CGATTCCAGCAAGCGCAAGCAGCTGGACAGCGACGGCCAGCCAGACTCTGTCCCCAGTGTGAAGAGGAGGCGGCTGATAC
CCGAGATGGGTCTTTGTCCACTGNAACCTTGATACAGGATCTTCTCTTTCCACCACACCGCTGATTCCCTGCGAAACCAC
GCCTCTTAGGTGTGAGCAGGATACCCTTAGTTCTTTCCCAGAGTCCTCCAGTCTTTTCTCCGAGCCCGTCTCTGTTCACC
TCTACCACCCACCGACTTGCAGAAGCACCCTCCACCGGGCAACCTAAATGAAGTCTGCAAAAACACTGAAGAAATAGTCA
CTAAGAAAACCCGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGGGNCTTGAAGACAGT
GACCAATGNGGCTCATANTACTTTAAAATTANATTAAAATCCTTTTGGGTGTGTTATNANGNGGTGGAAACCTTGTGAAA
Sequence Type mRNA
Unitrap ID UNI18663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43213448..43215375 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es