Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE043
Clone ID RRE043
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE043
Sequence
AGTCAGAATCCAGTTCCCATCCTGCCTTGAGCCAGTCACCAATGCCACAGGAAAGAGGTTTTATGACAGGCACTCAGAGA
AACCCTCAGATGTCTCAGTACGGACCTCAGCAGACAGGACCATCCATGTCGCCTCACCCATCTCCTGGGGGCCAGATGCA
TCCTGGGATCAGTAACTTTCAGCAGAGTAACTCAAGTGGCACGTACGGCCCACAGATGAGCCAGTATGGACCCCAAGGCA
ACTACTCCAGAACCCCAACATATAGCGGGGTACCCAGTGCAAGCTACAGCGGCCCAGGGCCCGGTATGGGCATCAATGCC
AACAACCAGATGCATGGACAAGGGCCAGCCCAGCCATGTGGTGCTATGCCCCTGGGACGAATGCCTTCAGCTGGGATGCA
GAACAGACCATTTCCTGGAACCATGAGCAGCGTCACCCCCAGTTCTCCTGGCATGTCTCAACAGGGAGGGCCAGGAATGG
GCCCACCAATGCCCACTGTGAACCGGAAGGCCCAGGAAGCTGCCGCAGCTNGTGATGCAGGCTGCTGCAAACTCAGCACA
AAG
Sequence Type mRNA
Unitrap ID UNI9158

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5264065..5291280 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es