Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36283
Clone ID OST36283
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36283
Sequence
AAACACGGAAGGATTATGACTACATGCTGGATCACCCAGAANAATACTATAGCCATTACTACCACTACTACAGCAGGCGC
CTGGCCCCAAAAGTGGACGTTAGGGTGGTGATT
Sequence Type mRNA
Unitrap ID UNI28238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59030549..59030661 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070972 (2010203O07Rik) NM_001033165 DnaJ (Hsp40) homolog, subfamily C , member 25 Gene [Source:MGI Symbol;Acc:MGI:1919679]

 
Come back to gene ENSMUSG00000070972


For any suggestions or comments, please send an email to unitrap@crg.es