Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36267
Clone ID OST36267
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36267
Sequence
ACTTGGTTTCAAAAGCATAGAAAAATACGGAAGCAAGCAGAGTTTGCATGCTGTTCTGAAGAAAGCCAAGAGCAGGAGCA
GGATAAACCTAGAGTTAAAGAAGCTAGAAGGAGCAGAACGCACTTCACAAAGTTCCAGACTGATATTCTAATTGAAGCTT
TTGAGAAGAATCGGTTCCCTGGGATTGTTACCAGGGAAAAACTGGCTCAACAAACAGGCATCCCAGAATCCAGGANNNAT
ATATNGNTNNAAAANCGNTNNGCNCGGNNCCCANACCCAGGACAGAACNCTCAGAAAACTCCTNATCCACCCCAGAGCAG
TCAGGGCCCTACCCAGAAAACTGTGGGTAAACTCGCTCCTTCCAAAACTCTCACCAGCAGCGCTTCAGTTATACTGCCTC
TTTCTCCACCCCACACTCC
Sequence Type mRNA
Unitrap ID UNI28240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26806251..26808423 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048502 (AC175032.1-202) NM_183389 double homeobox B-like [Source:RefSeq peptide;Acc:NP_899245]

 
Come back to gene ENSMUSG00000048502


For any suggestions or comments, please send an email to unitrap@crg.es