Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36177
Clone ID OST36177
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36177
Sequence
GTCCCGCTTTCTGGTGACAGCCCCAGGGATCATCAGACCCGGAGCAAATGTGACTATTGGGGTGGATCTCCTGGAAAATA
GCCCCCCACAGGTCCTTGTAAAGGCTCAGGTGTTCAAGATAGCTTCCAACAAATCGAGATCCATCCTGGAAGCAGAAGGA
GTCTTTCACAGAGGCCATTTCAAGACTCTCGTTCTTCCGGCACTACCTCTGAGCAGTGCAGATAAGATTTATGAGCTACA
CATAAACGGACAATCAGAGAATGAGATCGTATTCTCCAACAGGACACGTTTAACATTTGAGAGCAAGAGTATATCTGTCC
TCATTCAGACAGACAAGGCATTCTACAAGCCGAAGCAGGAAGTGAAGTTTCGGGT
Sequence Type mRNA
Unitrap ID UNI28242

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78464684..78484428 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046186 (Cd109) NM_153098 CD109 antigen Gene [Source:MGI Symbol;Acc:MGI:2445221]

 
Come back to gene ENSMUSG00000046186


For any suggestions or comments, please send an email to unitrap@crg.es