Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST36060
Clone ID OST36060
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST36060
Sequence
GATCGGAACGTCAATTAACGTCAATTAACATCTGACGCTGCCCCTCCCCCATCTACTTACCACCACCCTTTCCCAACCCC
AACCATGTTTTTTGTGTGTCAATTGTGCCATTTTTATTTTATTCCTTTCCCTACTGTACACGGAGAAATAAAGGTGTAGA
AATAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21102746..21102869 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007564 (Ppp2r1a) NM_016891 protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform Gene [Source:MGI (curated);Acc:Ppp2r1a-001]

 
Come back to gene ENSMUSG00000007564


For any suggestions or comments, please send an email to unitrap@crg.es