Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35912
Clone ID OST35912
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35912
Sequence
GACGGAGTTGTTTCGATCTCTTTTCGGCCAGCTCAACCCTCCTGATGCAGACCGTGGGAAGTGACAGTAGCATCCTCTCA
GGCCCGACCTCAGCACAGGACCCACCTGCTGCCTCCAATAAAATGATCAAAAACTACAATAAACCTTTTTTTTTTTAAAA
AAAAAAA
Sequence Type mRNA
Unitrap ID UNI28254

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84236364..84236521 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018697 (Aatf) NM_019816 apoptosis antagonizing transcription factor Gene [Source:MGI (curated);Acc:Aatf-001]

 
Come back to gene ENSMUSG00000018697


For any suggestions or comments, please send an email to unitrap@crg.es