Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35870
Clone ID OST35870
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35870
Sequence
ACATTAACGAGCTGAACCTGCCCAAGACGTGTGACATCAGCTTCTCAGACCCAGACGACCTCCTCAACTTCAAGCTGGTG
ATCTGTCCTGATGAAGGCTTCTACAAAAGTGGCAAGTTTGTATTCAGCTTTAAGGTGGGACAGGGTTACCCACATGACCC
TCCCAAGGTGAAGTGTGAAACAATGGTTTATCATCCCAACATTGACCTCGAGGGCAACGTCTGCCTCAACATCCTCAGAG
AGGACTGGAAGCCAGTCCTTACGATAAACTCCATAATTTATGGCCTGCAGTATCTCTTCTTGGAGCCGAACCCTGAGGAC
CCACTGAACAAGGAGGCTGCTGAGGTCCTGCAGAACAACCGGCGGCTGTTTGAACAAAATGTGCAGCGCTCCATGAGAGG
TGGTTACATCGGGTCCACCTACTTCGAGCGCTGCCTGAAATAGGGTTAGCAATTACCCATCCCTGCCAGGGTTACCGGGC
CAGGCATTCCCTGCAAATATTTATTGGGGGCCCGGGTAAGGTGTGTNGGGTAGCCTTGGCCCCCTGCCTTGGCCTTGCCT
CTCTT
Sequence Type mRNA
Unitrap ID UNI14752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13620842..13622009 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005575 (Ube2m) NM_145578 ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene [Source:MGI (curated);Acc:Ube2m-001]

 
Come back to gene ENSMUSG00000005575


For any suggestions or comments, please send an email to unitrap@crg.es