Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35865
Clone ID OST35865
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35865
Sequence
GTCCTATGGATGGAGAATTGCCACCAAGAGCTAGAAACCAGACCAATAACCCAGCAGCCACCAACCATGCTGGAAGGCAT
CCGAGGGCCAGCAACCATCCTGCTCCTTTCCGACAGAGGGAAGAGAGATTTAGGGCTATGGGCAGGAACCCACATCAGGG
AAGAAGAAACCAGGAAGGGCATACCAGTGACGAAGCTAGAGACCAGAGACAAAGCCAGAATGACACCAGGAGGAGGAATG
ACGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166882198..166882441 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039501 (Znfx1) NM_001033196 zinc finger, NFX1-type containing 1 Gene [Source:MGI (curated);Acc:Znfx1-001]

 
Come back to gene ENSMUSG00000039501


For any suggestions or comments, please send an email to unitrap@crg.es