Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35799
Clone ID OST35799
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35799
Sequence
AAGGCCAAGGTTGAAATGGGAGGACGNTGCTGCCNAGACCATGCTGACAGCTGTGTGGNGAGCAGAGATGATGAGGAGCT
GTCTAGGGACAAAGATGTGTACGTGACTACCCATACTCCTCGAAGCACCAAGGATGATGGAGCTACTGGACCCAGGCCCT
CAGGTACCGTCAGTTGTCCTATCTGTATGGATGGATACTCTGAGATTGTGCAGAATGGGCGTCTCATTGTTTCTACAGAA
TGTGGCCACGTCTTCTGTAGCCAGTGCCTCCGTGATTCCCTTAAGAATGCTAACACTTGCCCAACTTGTAGGA
Sequence Type mRNA
Unitrap ID UNI5200

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34692568..34693988 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029110 (Rnf4) NP_035408 ring finger protein 4 Gene [Source:MGI Symbol;Acc:MGI:1201691]

 
Come back to gene ENSMUSG00000029110


For any suggestions or comments, please send an email to unitrap@crg.es