Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35791
Clone ID OST35791
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35791
Sequence
GGCTTTTTCAACAAGAGGCCACGGCGCACCTCCAGGGGGCCCTGGACCCCGCCAGCAGCAGGCAGGTGCCCGACTGGGTG
CTGCCCAATCTCCTTTCAGTGACCTGAACCGGCAGCTGGTGAACATGGGCTTCCCACAATGGCACCTTGGGAACCACGTG
GTGGAACCTGTGACCTCCATCCTCCTGCTCTTCCTGCTTATGATGCTCGGGGTTCGTGGCCTCCTGCTTGTGGGCCTGGT
CTACCTGGTGTCTCACCTGAGTCAGCGGTGACCTCCGGGGGACTCATGAGGGCGGGAGTGTTCAGTAGGATTGACTGGAC
TGGGCTTTGGTGCGACATCATGCACAGGGGGAGGGAGCTTGGGTGGGCTCAGANGGTGTGATGGGCATGAAACCGGCTTT
GTAGAT
Sequence Type mRNA
Unitrap ID UNI28262

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61571467..61571871 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020083 (2010107G23Rik) NM_027251 RIKEN cDNA 2010107G23 gene Gene [Source:MGI Symbol;Acc:MGI:1917144]

 
Come back to gene ENSMUSG00000020083


For any suggestions or comments, please send an email to unitrap@crg.es