Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35786
Clone ID OST35786
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35786
Sequence
GAGTCTGTGTCGATGCACGTTAACACTCAGGGCCAGTCAGCGCTCTTTGTTGCAGCATTACTGGGCCATGTGAAATTAGT
GGATGTTCTGGTGGATTATGGATCAGATCCAAATCAGTAAGTATAATAATATCAATCTCTAGAAAACAAAAAA
Sequence Type mRNA
Unitrap ID UNI14388

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87287906..87288055 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010342 (Tex14) NP_113563 testis expressed gene 14 Gene [Source:MGI (curated);Acc:Tex14-001]

 
Come back to gene ENSMUSG00000010342


For any suggestions or comments, please send an email to unitrap@crg.es