Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST35733
Clone ID OST35733
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST35733
Sequence
GTAAGCATCCCAGCCCAAAACTTGTGTCGTGAAATCCAAGACTTTGACCCAGATAATGTGATAGGATCTTCCTGTGACTT
GGGGCCATATTCTACTTAGATGAACTCGGAACTTCCAGCTTTCCCGAGCGCTTGGCACTACAGGCAGGCTTCTTGCTTGC
TTGGTATACGTTACCATGCCATCTCTGCCTCAAGATGGGGTTATTCAGGGATCATCTCCTGTGGATCTGGGTACAGAATT
ACCTTACCAATGCACAATGAAAAGGAAAGTGAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146556968..146557409 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036745 (Ttll7) tubulin tyrosine ligase-like family, member 7 Gene [Source:MGI (curated);Acc:Ttll7-001]

 
Come back to gene ENSMUSG00000036745


For any suggestions or comments, please send an email to unitrap@crg.es