Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE117
Clone ID RRE117
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE117
Sequence
ACCTGACATGAACTACGAGACCATGGGGAGAGCACTCAGGTACTATTACCAAAGAGGTATTCTTGCAAAAGTGGAAGGTC
AGCGCTTGGTGTATCAGTTTAAAGAAATGCCAAAAGATCTTATCTACATAGATGATGAGGATCCAAGTTCCAGCATAGAG
TCTTCGGATCAGTCCTTATCGTCAACAACCGCATCAAGTCGGAATCAAGCAAACCGATCAAGAGTATCTTCAAGTCCAGG
AATTAAAGGAGGGGCCGCTACAATTCTAAAGCCCGGGAATTCTAAAGCTGCAAACCCCAAAGATCCGGTGGAAGTTGGAC
AACCTTCAGAAGTTCTGAGGACAGTGCAACCCTCACAGGCTCCCTATCCTACCCAGCTCTTCCGAACTGTTCATGTAGTA
CAGCCAGTACAAGCTGTCCCAGAGGAAGCAACCATAGCCAGCACCATGCAGGAGGAAGCAGCAAATTCTTCAGTTCCAAG
TATT
Sequence Type mRNA
Unitrap ID UNI9170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79970684..79973423 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]

 
Come back to gene ENSMUSG00000036461


For any suggestions or comments, please send an email to unitrap@crg.es